Java - Ayuda, JAVA

   
Vista:

Ayuda, JAVA

Publicado por Lalo (2 intervenciones) el 03/04/2016 21:37:03
(En este ya lo tengo hecho, solo que al ejecutar el programa e introducir la caneda me aparece toda la cadena como aaaccgtgcg y me aparece a3a3a3c3c3g3t1g3c3g3, y solo quiero que me aparezca a3c3g3t1 alguna ayuda en ese tema?, algun consejo? porfavor)
Una cadena de ADN está representada por los símbolos “A”, “C”, “G”, “T” (Adenina, Citosina, Guanina, Tiamina). Ejemplo: “AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC”
Dada una cadena de ADN introducida por el usuario, calcula cuántas veces aparece cada nucleótido en la cadena.

-----------------------------------------------------------------------------------------------------------------------------------------------------
(En este si estoy en blanco no tengo ni idea de que tengo que hacer, no pido que me hagan el programa solo que me den consejos de que usar o algo por el estilo, porfavor)
Tenemos un juego con un programa antiguo que almacena la información con una lista de letras para cada puntaje. Ejemplo:  1 punto: "A", "E", "I", "O", "U", "L", "N", "R", "S", "T",  2 puntos: "D", "G",  3 puntos: "B", "C", "M", "P",  4 puntos: "F", "H", "V", "W", "Y",  5 puntos: "K",  8 puntos: "J", "X",  10 puntos: "Q", "Z",
Sin embargo, también se tiene el nuevo sistema que almacena los mismos datos de manera diferente (un puntaje por letra). Lo cual permite saber el puntaje de una palabra más fácilmente.  "a": 1 punto.  "b": 3 puntos.  "c": 3 puntos.  "d": 2 puntos.  etc.

-----------------------------------------------------------------------------------------------------------------------------------------------------
(Este tambien ya lo tengo casi "terminado" solo que estoy poniendo uno a uno las sumas de los puntajes en if,elseif y else. alguna ayuda para hacerlo mas corto? tengo como 50 if's hasta ahorita xD)
Dado un puntaje de Alergias de una persona, desarrolla un programa que diga a qué cosas es alérgica la persona.
Tenemos esta lista de puntajes:  huevos (1)  cacahuates (2)  camarones (4)  fresas (8)  tomates (16)  chocolate (32)  polen (64)  gatos (128)
Entonces, si una persona es alérgica a “cacahuates” y “chocolate”, el puntaje es 34.
El programa debe solicitar el puntaje a verificar y decir cuáles son las alergias. Ejemplo: Si el usuario captura el puntaje 34, el programa debe imprimir como salida:  Si la persona es alérgica o no a algún elemento de la lista  A qué elementos es alérgica la persona

NO PIDO QUE ME REALICEN LOS PROGRAMAS SOLO QUE ME DEN UN CONSEJO O UNA AYUDA EN CUANTO A QUE USAR O COMO USARLO, SOY BASTANTE NUEVO EN ESTO APENAS ES MI PRIMER CLASE DE JAVA EN LA UNIVERSIDAD. GRACIAS
Valora esta pregunta
Me gusta: Está pregunta es útil y esta claraNo me gusta: Está pregunta no esta clara o no es útil
0
Responder