PDF de programación - Programación en Python 2

Imágen de pdf Programación en Python 2

Programación en Python 2gráfica de visualizaciones

Publicado el 14 de Enero del 2019
914 visualizaciones desde el 14 de Enero del 2019
313,9 KB
30 paginas
Creado hace 5a (02/12/2015)
PROGRAMACIÓN EN
PYTHON 2

Clara Higuera
Laboratorio Integrado de Biofísica y
Bioinformática
Nov-2015



Funciones

funcion

print “Esta es mi función”

x

y

funcion

funcion

z
w

w

Funciones
•  Las funciones sirven para encapasular código y pueden
tener o no tener parámetros de entrada
•  Definición:



def nombre_funcion():
print "Hola Mundo"

•  Llamada:

•  Una función, no es ejecutada hasta que no sea llamada. Para llamar a

una función, simplemente se indica su nombre.

funcion()

Funciones
•  Cuando una función queremos que devuelva un dato
utilizamos return. Este valor puede ser utilizado para
asignarlo a una variable.

Funciones
•  Cuando una función queremos que devuelva un dato
utilizamos return. Este valor puede ser utilizado para
asignarlo a una variable.

Podemos llamar a una función
pasándole literales (numeros,
cadenas,…) o variables

Funciones
•  Podemos utilizar cualquier tipo de datos de entrada y
•  Para documentar la función usamos con comillas

salida

triples debajo de la definición

Devuelve 2
elementos

Funciones
•  Ejercicio 1

•  Definir una función que reciba como parámetros dos variables

numéricas y devuelva la media

•  Llamar a la función e imprimir el resultado

•  Ejercicio 2

•  Definir una función que reciba como parámetros 2 cadenas y

devuelva una cadena resultado de la concatenación de las dos
cadenas

Modulos
•  Forma de reutilizar código
•  Agrupan funciones y objetos relacionados
•  Por ejemplo, math
•  Hay que importarlos

1. Todo el módulo
>>import math

>>> math.sqrt(2)
1.4142135623730951


2. Todo el módulo, con un alias, para abreviar
>>> import math as m

>>> m.sqrt(2)
1.4142135623730951


3. Importar dentro del espacio de nombres actual

>>> from math import sqrt

>>> sqrt(2)
1.4142135623730951


Cuidado. Podemos
reemplazar funciones
preexistentes

Modulos
•  Buscar ayuda:

>>> import math
>>> help(math) # Ayuda del modulo
>>> help(math.sqrt) # Ayuda de la función


Ejercicio:

•  Usando la ayuda (o internet)

•  Buscar como hacer senos, cosenos y exponenciales
•  Logaritmos neperianos y decimales
•  Redondeos al entero superior, al inferior y al más cercano
•  Valores absolutos

Modulos: numpy
•  Las listas se pueden utilizar para simular vectores y matrices,
pero son bastante inconvenientes
•  Por ejemplo, la suma de dos listas no suma los componentes
(no tendría sentido: distintos tipos)

•  El módulo numpy proporciona arrays eficientes

>>> import numpy as np
>>> vector = np.array([1,2,3])


•  Datos de un solo tipo (todos float, todos int)
•  Acceso como en listas y tuplas

>>> vector[0]
>>> vector[2:5]


Modulos: numpy
•  También podemos crear matrices


>>> matriz = np.array([[1,2,3],[0,1,0]])

•  Acceso

>>> matriz[0,2]
>>> matriz[0][2]
3



•  Filas y columnas:

>>> matriz[0]; matriz[0,:]
>>> matriz[:,0]

Devuelven la primera fila
Devuelven la primera columna

Modulos: numpy
•  Operaciones basicas

>>> v = np.array([1,2,3])
>>> u = np.array([3,2,1])
>>> v + u
array([4, 4, 4])

•  Método para obtener el número de dimensiones:

>>> matriz.ndim
2


•  Forma de la matriz: (num filas, num columnas)

>>> matriz.shape
(2, 3)

•  Siempre que se mantenga el número de elementos, la forma se

puede alterar

>>> matriz.shape = (3,2)

Modulos: numpy
•  Funciones útiles

Vector de números enteros:

̶ np.arange(10)
̶ np.arange(6,12,2)

Rango de valores reales

(inicio,fin, incremento)
Se excluye el último!
Podemos poner, 1, 2 o 3 args

̶ np.linspace(0,1,10)
array([ 0. , 0.11111111, 0.22222222, 0.33333333, 0.44444444,
0.55555556, 0.66666667, 0.77777778, 0.88888889, 1.])


Matriz de unos:

̶ Matriz diagonal:

np.ones((3,3))



̶ np.diag([1,2,3])

Modulos: numpy
λ  Ejercicio 3:

λ  Buscar en la ayuda (o internet) como hacer la matriz identidad y

cómo generar números aleatorios

λ  Ejercicio 4:
•  Crear los siguientes arrays

•  Vector con números descendentes del 30 al 0, de 3 en 3
•  Matriz identidad 5x5
•  Matriz con números del 1 al 5 en la diagonal
•  Lo mismo pero del 2 al 10, de 2 en 2
•  ¿Qué submódulo permite generar números aleatorios?
•  Hacer una matriz de 2x3 de números aleatorios

Modulos: numpy
•  EJERCICIO PARA EL CAMPUS:

•  Escribir una función que tome una matriz y muestre uno a uno sus

elementos, indicando para cada uno su fila y columna.

•  Pista: utilizar el atributo de matrices .shape

Más sobre listas, cadenas y diccionarios

λ El operador in permite averiguar si un elemento
pertenece a una lista o cadena

>>> nombre = "Tarquinio"
>>> lista = ['rojo',’verde',35]
>>> "a" in nombre
True
>>> "qui" in nombre
True
>>> "e" in nombre
False
>>> 35 in lista
True

λ Devuelve booleano: se puede usar en condiciones de if y while

Más sobre listas, cadenas y diccionarios

λ En diccionarios, in comprueba claves, no valores

>>> dicc = {"A": 30, "B": "C"}
>>> "A" in dicc
True
>>> "C" in dicc
False

λ Para comprobar si está un valor:

>>> "C" in dicc.values()
True


λ Para evitar que una busqueda por clave de error, usar get

>>> dicc["D"] # ERROR
>>> dicc.get("D","No existe")
'No existe'

Más sobre listas, cadenas y diccionarios

En diccionarios y listas (pero no en tuplas ni cadenas) se pueden eliminar
elementos usando del


>>> dicc = {"A": 30, "B": "C"}
>>> del dicc["A"]
>>> dicc
{"B": "C"}
>>> lista = [0,10,20,30,40]
>>> del lista[1]
>>> [0, 20, 30, 40]

λ En listas también funcionan rangos

>>> del lista[3:5]

λ Y, también en listas, se puede eliminar por valor

>>> lista.remove(30) # Elimina el primer elemento 30

Método asociado al objeto lista

Más sobre listas, cadenas y diccionarios

λ En diccionarios, asignar una nueva clave equivale a insertarla

>>> mapa = dict([("A",30),("B",10)]) # Lista de tuplas
>>> mapa["C"] = 15
>>> mapa
{'A': 30, 'C': 15, 'B': 10}

λ Si la clave existía, se sustituye el valor
>>> mapa = dict(A = 30, B = 10)
>>> mapa
{'A': 30, 'B': 10}
>>> mapa["A"] = 2
>>> mapa
{'A': 2, 'B': 10}

Formas alternativas de crear diccionarios,

usando el constructor dict

Más sobre listas, cadenas y diccionarios

λ En listas, las inserciones se hacen con insert

>>> timeline = [1666,1789,1863,1945]
>>> timeline.insert(2,1812)
>>> timeline
[1666, 1789, 1812, 1863, 1945]

λ También con append, si son al final (o si es vacía)

>>> timeline.append(1989)
>>> timeline[1666, 1789, 1812, 1863, 1945, 1989]
>>> nombres = []
>>> nombres.append(‘Manolo')
>>> nombres
>>> [’Manolo']


Más sobre listas, cadenas y diccionarios
λ El último elemento de una lista se puede obtener con pop

>>> proteinas = ['Ras','PLC','EGFR']
>>> proteinas.pop()
'EGFR'
>>> proteinas
['Ras', 'PLC']


λ Admite índices concretos

>>> lista = ['A','B','C','D','E']
>>> d = lista.pop(3)
>>> lista
['A','B','C','E']

Más sobre listas, cadenas y diccionarios

λ Las listas se pueden ordenar con sort

>>> cuentas = [1,34,12,7,21]
>>> cuentas.sort()
>>> cuentas
[1, 7, 12, 21, 34]

λ Y se pueden invertir con reverse
>>> lista = ['A','B','C','D','E']
>>> lista.reverse()
>>> lista
['E', 'D', 'C', 'B', 'A']

Más sobre listas, cadenas y diccionarios

Ejercicio 5.

Escribir un script que haga lo siguiente:

1.  Cree una lista que contenga los nombres de las bases: Adenina,

Guanina, Citosina, Timina

2.  Añadir una más al final
3.  Ordenar la lista alfabéticamente
4.  Eliminar la base en la segunda posición
5. 
6. 

Invierte la lista
Imprimir el número de elementos


Imprimir la lista después de cada paso.

Más sobre listas, cadenas y diccionarios
Por desgracia, reverse no funciona con cadenas. ¿Qué podemos hacer?

Opción 1:

λ Se puede convertir una cadena en una lista

>>> deletreo = list("hola")
>>> deletreo
['h', 'o', 'l', 'a']
>>> deletreo.reverse()
['a', 'l', 'o', 'h']

λ Para devolver la cadena, usar join

>>> "".join(deletreo)
'aloh'

λ Las comillas encierran un separador. Por ejemplo:

>>> "-".join(deletreo)
'a-l-o-h'

Más sobre listas, cadenas y diccionarios
Por desgracia, reverse no funciona con cadenas. ¿Qué podemos hacer?

Opción 1:

λ Se puede convertir una cadena en una lista

>>> deletreo = list("hola")
>>> deletreo
['h', 'o', 'l', 'a']
>>> deletreo.reverse()
['a', 'l', 'o', 'h']

λ Para devolver la cadena, usar join

>>> "".join(deletreo)
'aloh'

Opción 2:

Cadena=“hola”
Cadena=Cadena[::-1]

λ Las comillas encierran un separador. Por ejemplo:

>>> "-".join(deletreo)
'a-l-o-h'

Más sobre listas, cadenas y diccionarios

λ Más operaciones con cadenas

>>> dna = 'aggtctagtacgtagctaggtaacgtat\n'

— Cambio entre mayúscula y minúsculas

>>> dna.upper() # A mayusculas
>>> dna.lower() # A minúsculas

— Eliminar caracteres blancos (espacios, '\n', '\t') en los extremos

>>> dna.rstrip() # Elimina a la derecha
>>> dna.lstrip() # Elimina a la izquierda
>>> dna.strip() # A ambos lados
>>> "AGCCGG".rstrip("G") # Elimina las Gs a la derecha
'AGCC'
COMPROBAR SIEMPRE CÓMO FUNCIONA LA FUNCIÓN QUE VAIS
A USAR, UNAS MODIFICAN EL OBJETO Y OTRAS DEVUELVEN UN
OBJETO NUEVO

Más sobre listas, cadenas y diccionarios

λ Más operaciones con cadenas

>>> dna = 'aggtctagtacgtagctaggtacgtat\n'

— Comienzo y fin

>>> dna.startswith('aggt') # True
>>> dna.endswith('cg') # False
>>> dna.startswith('ct',4) # A partir de dna[4]
True

— Busquedas (ver también expresiones regulares)
>>> dna.find('tacg') # Primera aparicion
8
>>> dna.find('tacg',9) # Desde la posicion 9
20
>>> dna.rfind('tacg') # Primera por la derecha
20

Más sobre listas, cadenas y diccionarios

λ Más operaciones con cadenas

>>> dna = 'aggtctagtacgtagctaggtacgtat\n'

λ Sustituciones

>>> dna.replace('tacg', 'TACG')
'aggtctagTACGtagctaggTACGtat\n'
>>> dna.replace('g', 'G', 3) # Solo las 3 primeras
'aGGtctaGtacgta
  • Links de descarga
http://lwp-l.com/pdf14846

Comentarios de: Programación en Python 2 (0)


No hay comentarios
 

Comentar...

Nombre
Correo (no se visualiza en la web)
Valoración
Comentarios...
CerrarCerrar
CerrarCerrar
Cerrar

Tienes que ser un usuario registrado para poder insertar imágenes, archivos y/o videos.

Puedes registrarte o validarte desde aquí.

Codigo
Negrita
Subrayado
Tachado
Cursiva
Insertar enlace
Imagen externa
Emoticon
Tabular
Centrar
Titulo
Linea
Disminuir
Aumentar
Vista preliminar
sonreir
dientes
lengua
guiño
enfadado
confundido
llorar
avergonzado
sorprendido
triste
sol
estrella
jarra
camara
taza de cafe
email
beso
bombilla
amor
mal
bien
Es necesario revisar y aceptar las políticas de privacidad